Description in FASTA title prevents correct reformatting

[wbazant]

I have a file with reads formatted like:

@SRR3132037.1 1 length=142
AAGGCGGCTGTTGTTATGTTATCGGCTCCATGCGAAACAGCAAAATTATTACAGCCCAGCGCATGTTACTGGTTCGCCTGTACCAGTTAGCAGAAAGGCGCGACCGTGTAACAGACGTACCGCGCCCCATCGCTATTTATCT
+SRR3132037.1 1 length=142
/EEEEEEAEE/EEAEAEEEEEEEEEEE/EEEEEEEE6EEEEEEEEAEEEEEAEEAAA/AEEEEEAEEEEEEE/EE/EEAAE/EEEEEEEEAEE//EEE<EEEA/<E</<E/<EAEEAAA<EEEEEEA6EEEEA<E/EEEE<E

It's not a bad file according to https://en.wikipedia.org/wiki/FASTQ_format, and it's a default format from fastq-dump.

It's reformatted as such:

head -n4 reordered_c1gxnbm__reformatted_identifierslaj96u_u_reads reordered_6p35sxlp_reformatted_identifiersz4yibe76_reads_R
==> reordered_c1gxnbm__reformatted_identifierslaj96u_u_reads <==
@SRR3132037.1.11length=142
AAGGCGGCTGTTGTTATGTTATCGGCTCCATGCGAAACAGCAAAATTATTACAGCCCAGCGCATGTTACTGGTTCGCCTGTACCAGTTAGCAGAAAGGCGCGACCGTGTAACAGACGTACCGCGCCCCATCGCTATTTATCT
+SRR3132037.1.1 1 length=142
/EEEEEEAEE/EEAEAEEEEEEEEEEE/EEEEEEEE6EEEEEEEEAEEEEEAEEAAA/AEEEEEAEEEEEEE/EE/EEAAE/EEEEEEEEAEE//EEE<EEEA/<E</<E/<EAEEAAA<EEEEEEA6EEEEA<E/EEEE<E

==> reordered_6p35sxlp_reformatted_identifiersz4yibe76_reads_R <==
@SRR3132037.1.21length=142
AACCAGTTTGAATTTGGCATTTTCAACGACCGCACCGACAACGGCATCGCCTTTCAAATCTGCCGGGCAGTCTTTTAAATCGGCAATGGACTGGTGATCCATAATAATATGTACGCCTTTATCCCGCGCCGCACCTAATCCC
+SRR3132037.1.2 1 length=142
/A/EEEEAEEEEEEEEEEEEEEAEEEEAAEEAEE<6E<EEEAEEEEEEAEAEEEAEAEEEEEAE/AEAEE<EE/EEEAEE/6EEA<EEEE//EEAAEA/E//EEA/A<EA/E/EEEAAE/AE</<6<<6AAE/EAAE<<A66

I've found this issue when running a fork under #16, which assumes the mates of reads are labelled. I think it's still an issue otherwise but not very severe - the kneaddata_bowtie2_discordant_pairs would, I guess, not match SRR3132037.1.11length=142 and SRR3132037.1.21length=142, as a consequence put them in a wrong file and the --strict option there wouldn't work correctly.

I have a workaround for the issue on my end, but if you like I am happy to fix it in the codebase. I see that utilities.get_reformatted_identifiers does some reformatting. I would change it to remove the description, and also format the quality line to just "+".